Stem-loop sequence hsa-mir-4435-1

AccessionMI0016775 (change log)
Symbol HGNC:MIR4435-1
DescriptionHomo sapiens miR-4435-1 stem-loop
Gene family MIPF0001220; mir-4435
Literature search

8 open access papers mention hsa-mir-4435-1
(56 sentences)

Stem-loop
   a    gcaaa     ---a   c      aga   a    u 
5'  ggca     uggcc    gag ucacac   ggg ugag g
    ||||     |||||    ||| ||||||   ||| |||| c
3'  ucgu     accgg    cuc agugug   ucc acuu a
   a    agaca     acga   -      acg   -    c 
Get sequence
Deep sequencing
252 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 87629755-87629834 [+]
intergenic
Database links

Mature sequence hsa-miR-4435

Accession MIMAT0018951
Sequence

10 - 

auggccagagcucacacagagg

 - 31

Get sequence
Deep sequencing490 reads, 27 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).