Stem-loop sequence hsa-mir-4433b

AccessionMI0025511 (change log)
Symbol HGNC:MIR4433B
DescriptionHomo sapiens miR-4433b stem-loop
Gene family MIPF0001826; mir-4433
Literature search

3 open access papers mention hsa-mir-4433b
(3 sentences)

Stem-loop
   u  ---g                            -          gaauau 
5'  gu    uucccuauccuccuuaugucccaccccc acuccuguuu      u
    ||    |||||||||||||||||||||||||||| ||||||||||       
3'  ca    aggggguaggaggaaugcaggguggggg ugaggacaaa      u
   a  agaa                            g          gaccac 
Get sequence
Deep sequencing
168 reads, 0 reads per million, 56 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 64340747-64340848 [-]
sense
OTTHUMT00000251686 ; PELI1-001; intron 1
OTTHUMT00000327082 ; PELI1-004; intron 1
OTTHUMT00000327080 ; PELI1-002; intron 1
OTTHUMT00000327081 ; PELI1-003; intron 2
ENST00000358912 ; PELI1-001; intron 1
ENST00000466177 ; PELI1-004; intron 1
ENST00000494203 ; PELI1-002; intron 1
ENST00000468869 ; PELI1-003; intron 2
Clustered miRNAs
< 10kb from hsa-mir-4433b
hsa-mir-4433achr2: 64340759-64340839 [+]
hsa-mir-4433bchr2: 64340747-64340848 [-]
Database links

Mature sequence hsa-miR-4433b-5p

Accession MIMAT0030413
Sequence

20 - 

augucccacccccacuccugu

 - 40

Get sequence
Deep sequencing76 reads, 38 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4433b-3p

Accession MIMAT0030414
Sequence

60 - 

caggaguggggggugggacgu

 - 80

Get sequence
Deep sequencing71 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).