Stem-loop sequence hsa-mir-4433a

AccessionMI0016773 (change log)
Previous IDshsa-mir-4433
Symbol HGNC:MIR4433A
DescriptionHomo sapiens miR-4433a stem-loop
Gene family MIPF0001826; mir-4433
Literature search

2 open access papers mention hsa-mir-4433a
(2 sentences)

Stem-loop
   c          c           c         uc   uga 
5'  auccuccuua gucccaccccc acuccuguu  ugg   a
    |||||||||| ||||||||||| |||||||||  |||    
3'  uaggaggaau caggguggggg ugaggacaa  acu   a
   a          a           -         --   uau 
Get sequence
Deep sequencing
118 reads, 5.45 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 64340759-64340839 [+]
antisense
OTTHUMT00000251686 ; PELI1-001; intron 1
OTTHUMT00000327082 ; PELI1-004; intron 1
OTTHUMT00000327080 ; PELI1-002; intron 1
OTTHUMT00000327081 ; PELI1-003; intron 2
ENST00000358912 ; PELI1-001; intron 1
ENST00000466177 ; PELI1-004; intron 1
ENST00000494203 ; PELI1-002; intron 1
ENST00000468869 ; PELI1-003; intron 2
Clustered miRNAs
< 10kb from hsa-mir-4433a
hsa-mir-4433bchr2: 64340747-64340848 [-]
hsa-mir-4433achr2: 64340759-64340839 [+]
Database links

Mature sequence hsa-miR-4433a-5p

Accession MIMAT0020956
Previous IDshsa-miR-4433-5p
Sequence

12 - 

cgucccaccccccacuccugu

 - 32

Get sequence
Deep sequencing72 reads, 45 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-4433a-3p

Accession MIMAT0018949
Previous IDshsa-miR-4433-3p
Sequence

51 - 

acaggagugggggugggacau

 - 71

Get sequence
Deep sequencing45 reads, 26 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).