Stem-loop sequence hsa-mir-4432

AccessionMI0016772 (change log)
Symbol HGNC:MIR4432
DescriptionHomo sapiens miR-4432 stem-loop
Stem-loop
   --             c g      u c    cc     a u u 
5'   gcaucuugcagag c uuccaa g gaca  ucuag g g c
     ||||||||||||| | |||||| | ||||  ||||| | |  
3'   cguagaacgucuc g aagguu c cugu  agauc c c a
   uc             a a      c a    -a     c - u 
Get sequence
Deep sequencing
8 reads, 16.7 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 60387362-60387445 [-]
intergenic
Database links

Mature sequence hsa-miR-4432

Accession MIMAT0018948
Sequence

65 - 

aaagacucugcaagaugccu

 - 84

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).