Stem-loop sequence hsa-mir-4431

AccessionMI0016771 (change log)
Symbol HGNC:MIR4431
DescriptionHomo sapiens miR-4431 stem-loop
Literature search

1 open access papers mention hsa-mir-4431
(1 sentences)

Stem-loop
   u    ugc        a              ugac        ucu 
5'  gguu   gacucuga aacuagaagguuua    ugggcauu   c
    ||||   |||||||| ||||||||||||||    ||||||||    
3'  ccaa   cugagacu uugaucuuucaagu    acccguaa   a
   c    uua        g              uaua        ccc 
Get sequence
Deep sequencing
315 reads, 5.56 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 52702522-52702615 [-]
intergenic
Database links

Mature sequence hsa-miR-4431

Accession MIMAT0018947
Sequence

7 - 

gcgacucugaaaacuagaaggu

 - 28

Get sequence
Deep sequencing294 reads, 14 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).