Stem-loop sequence hsa-mir-4429

AccessionMI0016768 (change log)
Symbol HGNC:MIR4429
DescriptionHomo sapiens miR-4429 stem-loop
Gene family MIPF0001474; mir-4429
Literature search

2 open access papers mention hsa-mir-4429
(2 sentences)

Stem-loop
   a   -agaaa  -     -cu         - ug  g 
5'  ggg      ag cuggg   gagaggcga c  gu u
    |||      || |||||   ||||||||| |  || c
3'  ccc      uc gacuc   cucucuguu g  ua u
   a   gguccg  a     aac         u uu  a 
Get sequence
Deep sequencing
682521 reads, 1.99e+03 reads per million, 138 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 11540605-11540677 [-]
antisense
OTTHUMT00000324045 ; AC099344.4-002; intron 1
OTTHUMT00000324044 ; AC099344.4-001; intron 2
OTTHUMT00000324047 ; AC099344.4-004; intron 2
OTTHUMT00000324046 ; AC099344.4-003; intron 3
ENST00000453100 ; LINC00570-002; intron 1
ENST00000417473 ; LINC00570-001; intron 2
ENST00000432665 ; LINC00570-004; intron 2
ENST00000437795 ; LINC00570-003; intron 3
Database links

Mature sequence hsa-miR-4429

Accession MIMAT0018944
Sequence

7 - 

aaaagcugggcugagaggcg

 - 26

Get sequence
Deep sequencing682498 reads, 139 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).