Stem-loop sequence hsa-mir-4428

AccessionMI0016767 (change log)
Symbol HGNC:MIR4428
DescriptionHomo sapiens miR-4428 stem-loop
Gene family MIPF0001630; mir-4428
Literature search

1 open access papers mention hsa-mir-4428
(1 sentences)

Stem-loop
   u    a   g       g    -      a   ua a 
5'  uggc ggu ccauguu ccug cuccuu cug  c c
    |||| ||| ||||||| |||| |||||| |||  |  
3'  accg ccg gguacaa gggc gaggaa ggu  g g
   u    -   a       -    a      c   cg u 
Get sequence
Deep sequencing
54 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 237471119-237471191 [+]
sense
OTTHUMT00000095402 ; RYR2-001; intron 2
ENST00000542537 ; RYR2-202; intron 1
ENST00000366574 ; RYR2-001; intron 2
ENST00000360064 ; RYR2-201; intron 3
Database links

Mature sequence hsa-miR-4428

Accession MIMAT0018943
Sequence

46 - 

caaggagacgggaacauggagc

 - 67

Get sequence
Deep sequencing24 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).