Stem-loop sequence hsa-mir-4427

AccessionMI0016766 (change log)
Symbol HGNC:MIR4427
DescriptionHomo sapiens miR-4427 stem-loop
Gene family MIPF0001640; mir-4427
Stem-loop
       c     g      -        --        
5' gaag cucuu gggcuu auuuagac  aaugguu 
   |||| ||||| |||||| ||||||||  |||||| u
3' uuuc gagaa ucugag uaagucug  uuacuac 
       u     g      a        cu        
Get sequence
Deep sequencing
11 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 233624152-233624219 [+]
intergenic
Database links

Mature sequence hsa-miR-4427

Accession MIMAT0018942
Sequence

44 - 

ucugaauagagucugaagagu

 - 64

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).