Stem-loop sequence hsa-mir-4425

AccessionMI0016764 (change log)
Symbol HGNC:MIR4425
DescriptionHomo sapiens miR-4425 stem-loop
Stem-loop
   g                   ca               uuug 
5'  ugcuuuacaugaauggucc  uugaaucccaacagc    c
    |||||||||||||||||||  |||||||||||||||     
3'  augaaaugugcuuaccagg  gacuuaggguuguug    g
   a                   ac               ugaa 
Get sequence
Deep sequencing
1578 reads, 15 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 25023503-25023586 [+]
intergenic
Database links

Mature sequence hsa-miR-4425

Accession MIMAT0018940
Sequence

50 - 

uguugggauucagcaggaccau

 - 71

Get sequence
Deep sequencing1572 reads, 35 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).