Stem-loop sequence hsa-mir-4424

AccessionMI0016763 (change log)
Symbol HGNC:MIR4424
DescriptionHomo sapiens miR-4424 stem-loop
Stem-loop
   c                       ca             uuu 
5'  uuacaucacacacagaguuaacu  aaauggacuaauu   c
    |||||||||||||||||||||||  |||||||||||||    
3'  gauguagugugugucucaauuga  uuuaccugauuga   c
   u                       ac             uca 
Get sequence
Deep sequencing
166 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 178677749-178677834 [+]
intergenic
Database links

Mature sequence hsa-miR-4424

Accession MIMAT0018939
Sequence

15 - 

agaguuaacucaaaauggacua

 - 36

Get sequence
Deep sequencing97 reads, 49 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).