Stem-loop sequence hsa-mir-4422

AccessionMI0016759 (change log)
Symbol HGNC:MIR4422
DescriptionHomo sapiens miR-4422 stem-loop
Stem-loop
   a            a   a            ua     cau 
5'  guucuucugcag caa agcaucaggaag  cccac   g
    |||||||||||| ||| ||||||||||||  |||||   u
3'  cgaggagacguu guu ucguaguucuuc  gggug   a
   c            a   c            cc     acc 
Get sequence
Deep sequencing
137 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 55225641-55225723 [+]
antisense
OTTHUMT00000027436 ; PARS2-001; intron 1
ENST00000371279 ; PARS2-001; intron 1
Database links

Mature sequence hsa-miR-4422

Accession MIMAT0018935
Sequence

16 - 

aaaagcaucaggaaguaccca

 - 36

Get sequence
Deep sequencing114 reads, 35 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).