Stem-loop sequence hsa-mir-4421

AccessionMI0016758 (change log)
Symbol HGNC:MIR4421
DescriptionHomo sapiens miR-4421 stem-loop
Gene family MIPF0001548; mir-4421
Stem-loop
   c     --        ug u  g  -   aa a u 
5'  ugggu  cuccuuuc  c ga ag uug  c c u
    |||||  ||||||||  | || || |||  | | g
3'  aucca  gaggaaag  g cu uc aac  g g u
   c     uc        gu u  g  c   ag - u 
Get sequence
Deep sequencing
994 reads, 0 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 51059837-51059905 [+]
antisense
OTTHUMT00000092438 ; FAF1-005; intron 2
OTTHUMT00000021808 ; FAF1-002; intron 3
OTTHUMT00000021807 ; FAF1-001; intron 9
ENST00000472808 ; FAF1-005; intron 2
ENST00000545823 ; FAF1-202; intron 2
ENST00000494400 ; FAF1-002; intron 3
ENST00000396153 ; FAF1-001; intron 9
ENST00000371778 ; FAF1-201; intron 10
Clustered miRNAs
< 10kb from hsa-mir-4421
hsa-mir-4421chr1: 51059837-51059905 [+]
hsa-mir-6500chr1: 51060018-51060103 [+]
Database links

Mature sequence hsa-miR-4421

Accession MIMAT0018934
Sequence

43 - 

accugucuguggaaaggagcua

 - 64

Get sequence
Deep sequencing947 reads, 70 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).