Stem-loop sequence hsa-mir-4420

AccessionMI0016757 (change log)
Symbol HGNC:MIR4420
DescriptionHomo sapiens miR-4420 stem-loop
Stem-loop
   c   ug  -  ga     ugu   -   a      u   u 
5'  ucu  gu au  acauc   gug uuc ugucuc cug g
    |||  || ||  |||||   ||| ||| |||||| |||  
3'  aga  cg ug  uguag   cac gag gcaggg gac c
   c   gu  a  uc     --u   u   a      -   a 
Get sequence
Deep sequencing
505 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 30739156-30739232 [-]
intergenic
Database links

Mature sequence hsa-miR-4420

Accession MIMAT0018933
Sequence

54 - 

gucacugaugucuguagcugag

 - 75

Get sequence
Deep sequencing489 reads, 16 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).