Stem-loop sequence hsa-mir-4326

AccessionMI0015866 (change log)
Symbol HGNC:MIR4326
DescriptionHomo sapiens miR-4326 stem-loop
Stem-loop
   --   g  cug       ucu    -       
5'   gcu cu   cuguucc   gucu cccaga 
     ||| ||   |||||||   |||| ||||| c
3'   cgg gg   gacgagg   uagg gggucu 
   ac   g  cug       ---    u       
Get sequence
Deep sequencing
1376 reads, 0.775 reads per million, 129 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 63286808-63286866 [+]
intergenic
Database links

Mature sequence hsa-miR-4326

Accession MIMAT0016888
Sequence

11 - 

uguuccucugucucccagac

 - 30

Get sequence
Deep sequencing1362 reads, 128 experiments
Evidence experimental; SOLiD [1]
Database links
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).