Stem-loop sequence hsa-mir-4324

AccessionMI0015854 (change log)
Symbol HGNC:MIR4324
DescriptionHomo sapiens miR-4324 stem-loop
Stem-loop
   --    c      --uua          cucca  gaac 
5'   cggc ccuuug     agggucucag     gg    u
     |||| ||||||     ||||||||||     ||    u
3'   gucg ggaaau     ucccagaguc     cc    u
   ac    u      uccaa          -----  aaaa 
Get sequence
Deep sequencing
9711 reads, 56.1 reads per million, 107 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 49308797-49308868 [-]
sense
OTTHUMT00000469996 ; BCAT2-012; intron 1
OTTHUMT00000466205 ; BCAT2-002; intron 1
OTTHUMT00000466203 ; BCAT2-008; intron 2
OTTHUMT00000466208 ; BCAT2-007; intron 2
OTTHUMT00000466202 ; BCAT2-001; intron 3
OTTHUMT00000466204 ; BCAT2-006; intron 3
OTTHUMT00000466207 ; BCAT2-004; intron 3
OTTHUMT00000466201 ; BCAT2-003; intron 4
OTTHUMT00000466209 ; BCAT2-005; intron 4
ENST00000545387 ; BCAT2-012; intron 1
ENST00000599246 ; BCAT2-002; intron 1
ENST00000593515 ; BCAT2-008; intron 2
ENST00000595376 ; BCAT2-007; intron 2
ENST00000316273 ; BCAT2-001; intron 3
ENST00000597011 ; BCAT2-006; intron 3
ENST00000598162 ; BCAT2-004; intron 3
ENST00000402551 ; BCAT2-003; intron 4
ENST00000601681 ; BCAT2-005; intron 4
Database links

Mature sequence hsa-miR-4324

Accession MIMAT0016876
Sequence

43 - 

cccugagacccuaaccuuaa

 - 62

Get sequence
Deep sequencing9704 reads, 111 experiments
Evidence experimental; SOLiD [1]
Database links
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).