Stem-loop sequence hsa-mir-4322

AccessionMI0015851 (change log)
Symbol HGNC:MIR4322
DescriptionHomo sapiens miR-4322 stem-loop
Literature search

1 open access papers mention hsa-mir-4322
(1 sentences)

Stem-loop
   ----a   c a         -   -   --gu   g    a 
5'      ccg g guuccgcgc cug gcc    guc cccc c
        ||| | ||||||||| ||| |||    ||| ||||  
3'      ggc c cggggugcg gac cgg    cag gggg g
   uacga   - -         c   u   gugu   -    a 
Get sequence
Deep sequencing
44 reads, 9.09 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 10230413-10230485 [+]
antisense
OTTHUMT00000451144 ; EIF3G-001; intron 1
OTTHUMT00000451147 ; EIF3G-006; intron 1
OTTHUMT00000451148 ; EIF3G-019; intron 1
OTTHUMT00000451149 ; EIF3G-018; intron 1
OTTHUMT00000451150 ; EIF3G-004; intron 1
OTTHUMT00000451151 ; EIF3G-005; intron 1
OTTHUMT00000451152 ; EIF3G-011; intron 1
OTTHUMT00000451154 ; EIF3G-007; intron 1
OTTHUMT00000451155 ; EIF3G-009; intron 1
OTTHUMT00000451156 ; EIF3G-010; intron 1
OTTHUMT00000451158 ; EIF3G-002; intron 1
OTTHUMT00000451159 ; EIF3G-008; intron 1
OTTHUMT00000451160 ; EIF3G-012; exon 1
OTTHUMT00000451161 ; EIF3G-003; intron 1
ENST00000253108 ; EIF3G-001; intron 1
ENST00000589454 ; EIF3G-006; intron 1
ENST00000587146 ; EIF3G-019; intron 1
ENST00000588709 ; EIF3G-018; intron 1
ENST00000589009 ; EIF3G-004; intron 1
ENST00000587590 ; EIF3G-005; intron 1
ENST00000593066 ; EIF3G-011; intron 1
ENST00000593095 ; EIF3G-007; intron 1
ENST00000587993 ; EIF3G-009; intron 1
ENST00000586151 ; EIF3G-010; intron 1
ENST00000589458 ; EIF3G-002; intron 1
ENST00000587681 ; EIF3G-008; intron 1
ENST00000587168 ; EIF3G-012; exon 1
ENST00000592485 ; EIF3G-003; intron 1
Database links

Mature sequence hsa-miR-4322

Accession MIMAT0016873
Sequence

43 - 

cugugggcucagcgcgugggg

 - 63

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).