Stem-loop sequence hsa-mir-4321

AccessionMI0015852 (change log)
Symbol HGNC:MIR4321
DescriptionHomo sapiens miR-4321 stem-loop
Literature search

2 open access papers mention hsa-mir-4321
(13 sentences)

Stem-loop
   --cu           a  -c  ug  c  cccga      cgc 
5'     ggucuccgcag gc  uc  cc cu     gacacc   u
       ||||||||||| ||  ||  || ||     ||||||    
3'     ccgggggcguc cg  ag  gg ga     uugugg   a
   cggu           c  cc  gu  c  -----      ucc 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 2250639-2250718 [+]
sense
OTTHUMT00000451278 ; AMH-003; exon 1
OTTHUMT00000451277 ; AMH-002; 3'UTR (exon 2)
OTTHUMT00000473253 ; AMH-004; exon 2
OTTHUMT00000451276 ; AMH-001; 3'UTR (exon 3)
ENST00000589313 ; AMH-003; exon 1
ENST00000592276 ; MIR4321-201; exon 1
ENST00000592877 ; AMH-002; 3'UTR (exon 2)
ENST00000609455 ; AMH-004; exon 2
ENST00000221496 ; AMH-001; 3'UTR (exon 3)
Database links

Mature sequence hsa-miR-4321

Accession MIMAT0016874
Sequence

50 - 

uuagcgguggaccgcccugcg

 - 70

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).