Stem-loop sequence hsa-mir-4313

AccessionMI0015843 (change log)
Symbol HGNC:MIR4313
DescriptionHomo sapiens miR-4313 stem-loop
Literature search

1 open access papers mention hsa-mir-4313
(2 sentences)

Stem-loop
   gau       ---a  -      --g    aa    ugc     c   uggagga 
5'    caggccc    gc ccccug   cccc  accc   agccc agc       u
      |||||||    || ||||||   ||||  ||||   ||||| |||        
3'    guccggg    ug ggggac   gggg  uggg   ucggg ucg       g
   -uc       gaaa  u      uaa    -g    --u     -   uagagga 
Get sequence
Deep sequencing
55 reads, 28 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 75762215-75762315 [-]
sense
OTTHUMT00000420321 ; PTPN9-003; exon 2
OTTHUMT00000420322 ; PTPN9-002; exon 3
OTTHUMT00000286474 ; PTPN9-001; exon 12
ENST00000568108 ; PTPN9-003; exon 2
ENST00000563835 ; PTPN9-002; exon 3
ENST00000306726 ; PTPN9-001; exon 12
Database links

Mature sequence hsa-miR-4313

Accession MIMAT0016865
Sequence

11 - 

agcccccuggccccaaaccc

 - 30

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).