Stem-loop sequence hsa-mir-4298

AccessionMI0015830 (change log)
Symbol HGNC:MIR4298
DescriptionHomo sapiens miR-4298 stem-loop
Literature search

6 open access papers mention hsa-mir-4298
(16 sentences)

Stem-loop
   -g    gg   -  -gg     -ga  ---ag     ag 
5'   ggga  uac cu   gacag   gg     gaggc  c
     ||||  ||| ||   |||||   ||     |||||   
3'   ccuu  aug ga   cuguc   cc     cuccg  c
   ca    gg   u  aaa     aaa  aaaga     uu 
Get sequence
Deep sequencing
50 reads, 9.68 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 1859464-1859536 [-]
intergenic
Database links

Mature sequence hsa-miR-4298

Accession MIMAT0016852
Sequence

11 - 

cugggacaggaggaggaggcag

 - 32

Get sequence
Deep sequencing45 reads, 29 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).