Stem-loop sequence hsa-mir-4280

AccessionMI0015889 (change log)
Symbol HGNC:MIR4280
DescriptionHomo sapiens miR-4280 stem-loop
Stem-loop
   a    ---     ga  g    uc      ga      a 
5'  auca   gggug  gu uagu  ugagca  gccuua a
    ||||   |||||  || ||||  ||||||  |||||| g
3'  uagu   uccac  ua guca  acuugu  uggagu g
   -    guu     ag  a    ga      -a      a 
Get sequence
Deep sequencing
74 reads, 0 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 87114879-87114954 [-]
intergenic
Database links

Mature sequence hsa-miR-4280

Accession MIMAT0016911
Sequence

11 - 

gaguguaguucugagcagagc

 - 31

Get sequence
Deep sequencing45 reads, 30 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).