Stem-loop sequence hsa-mir-4277

AccessionMI0015886 (change log)
Symbol HGNC:MIR4277
DescriptionHomo sapiens miR-4277 stem-loop
Stem-loop
   -cu    -     - -a uu       ca ua        ugcc 
5'    gggu cgagg c  g  cugagca  g  cacugggc    c
      |||| ||||| |  |  |||||||  |  ||||||||     
3'    cccg guucc g  c  gacucgu  c  gugacccg    c
   cuc    u     u aa uc       -- cc        ucac 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 1708785-1708868 [-]
intergenic
Database links

Mature sequence hsa-miR-4277

Accession MIMAT0016908
Sequence

11 - 

gcaguucugagcacaguacac

 - 31

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).