Stem-loop sequence hsa-mir-4270

AccessionMI0015878 (change log)
Symbol HGNC:MIR4270
DescriptionHomo sapiens miR-4270 stem-loop
Literature search

7 open access papers mention hsa-mir-4270
(19 sentences)

Stem-loop
   ---a  aauag    aggg  u           agaa 
5'     ca     cuuc    ag caggggagggc    a
       ||     ||||    || |||||||||||    u
3'     gu     gaag    uc guccccuuccg    a
   cugg  -gaaa    --gg  -           guag 
Get sequence
Deep sequencing
21 reads, 14.3 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 15496239-15496308 [-]
sense
OTTHUMT00000346318 ; COLQ-007; intron 14
OTTHUMT00000343575 ; COLQ-001; intron 15
OTTHUMT00000343577 ; COLQ-003; intron 15
OTTHUMT00000343576 ; COLQ-002; intron 15
ENST00000383786 ; COLQ-007; intron 14
ENST00000383787 ; COLQ-202; intron 14
ENST00000383788 ; COLQ-001; intron 15
ENST00000383781 ; COLQ-003; intron 15
ENST00000603808 ; COLQ-002; intron 15
ENST00000435459 ; COLQ-203; intron 15
ENST00000383785 ; COLQ-201; intron 16
Database links

Mature sequence hsa-miR-4270

Accession MIMAT0016900
Sequence

11 - 

ucagggagucaggggagggc

 - 30

Get sequence
Deep sequencing10 reads, 7 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).