Stem-loop sequence hsa-mir-4269

AccessionMI0015875 (change log)
Symbol HGNC:MIR4269
DescriptionHomo sapiens miR-4269 stem-loop
Literature search

1 open access papers mention hsa-mir-4269
(1 sentences)

Stem-loop
   acagc     ------g     aca     ccc       ug cucu 
5'      gcccu       caggc   gacag   uggcuuc  c    u
        |||||       |||||   |||||   |||||||  |     
3'      cgggg       guccg   cuguc   accgaag  g    u
   ----a     agguagg     -ga     -uc       gu uuuc 
Get sequence
Deep sequencing
59 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 239305462-239305545 [+]
sense
OTTHUMT00000328315 ; TRAF3IP1-004; intron 6
OTTHUMT00000328313 ; TRAF3IP1-002; intron 13
OTTHUMT00000328312 ; TRAF3IP1-001; intron 15
ENST00000462122 ; TRAF3IP1-004; intron 6
ENST00000391993 ; TRAF3IP1-002; intron 13
ENST00000373327 ; TRAF3IP1-001; intron 15
ENST00000391994 ; TRAF3IP1-201; intron 15
Database links

Mature sequence hsa-miR-4269

Accession MIMAT0016897
Sequence

11 - 

gcaggcacagacagcccuggc

 - 31

Get sequence
Deep sequencing29 reads, 19 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).