Stem-loop sequence hsa-mir-4268

AccessionMI0015874 (change log)
Symbol HGNC:MIR4268
DescriptionHomo sapiens miR-4268 stem-loop
Stem-loop
   ---a  c      g     -     uuuu   c 
5'     ug acauca guucu agagg    gcc u
       || |||||| ||||| |||||    ||| a
3'     ac uguagu uagga ucucc    cgg g
   gucc  -      g     c     uccu   c 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 219906502-219906565 [-]
intergenic
Database links

Mature sequence hsa-miR-4268

Accession MIMAT0016896
Sequence

34 - 

ggcuccuccucucaggaugug

 - 54

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).