Stem-loop sequence hsa-mir-4259

AccessionMI0015858 (change log)
Symbol HGNC:MIR4259
DescriptionHomo sapiens miR-4259 stem-loop
Literature search

2 open access papers mention hsa-mir-4259
(6 sentences)

Stem-loop
   -ga       -    ug    -  a ug g  ----------g       g g gg 
5'    ugggccc cuug  uccu ga u  g ug           gggcucu a u  g
      ||||||| ||||  |||| || |  | ||           ||||||| | |   
3'    acccggg ggac  ggga cu g  u ac           uccgggg u a  g
   agg       a    ug    u  g gu g  acuggagggga       g g aa 
Get sequence
Deep sequencing
33 reads, 10 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 159899979-159900079 [-]
sense
OTTHUMT00000059117 ; IGSF9-004; exon 4
OTTHUMT00000059116 ; IGSF9-003; exon 5
OTTHUMT00000059118 ; IGSF9-005; exon 14
OTTHUMT00000059109 ; IGSF9-002; exon 15
OTTHUMT00000059115 ; IGSF9-001; exon 15
ENST00000496645 ; IGSF9-004; exon 4
ENST00000493195 ; IGSF9-003; exon 5
ENST00000476102 ; IGSF9-005; exon 14
ENST00000361509 ; IGSF9-002; exon 15
ENST00000368094 ; IGSF9-001; exon 15
Database links

Mature sequence hsa-miR-4259

Accession MIMAT0016880
Sequence

70 - 

caguugggucuaggggucagga

 - 91

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).