Stem-loop sequence hsa-mir-4254

AccessionMI0015862 (change log)
Symbol HGNC:MIR4254
DescriptionHomo sapiens miR-4254 stem-loop
Literature search

3 open access papers mention hsa-mir-4254
(3 sentences)

Stem-loop
   ---c     a    --              ucu    uga 
5'     uuggg ggag  ggugggguggcucc   gcag   g
       ||||| ||||  ||||||||||||||   ||||   u
3'     gaccc ccuc  ccaccucaucgagg   cguc   a
   cccc     -    ua              -uc    ugg 
Get sequence
Deep sequencing
53 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 31758660-31758735 [-]
sense
OTTHUMT00000010662 ; SNRNP40-006; intron 1
OTTHUMT00000010657 ; SNRNP40-001; intron 4
ENST00000474025 ; SNRNP40-006; intron 1
ENST00000263694 ; SNRNP40-001; intron 4
ENST00000446633 ; SNRNP40-201; intron 4
Database links

Mature sequence hsa-miR-4254

Accession MIMAT0016884
Sequence

44 - 

gccuggagcuacuccaccaucuc

 - 66

Get sequence
Deep sequencing42 reads, 23 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).