Stem-loop sequence hsa-mir-412

AccessionMI0002464 (change log)
Symbol HGNC:MIR412
DescriptionHomo sapiens miR-412 stem-loop
Gene family MIPF0000192; mir-412
Literature search

10 open access papers mention hsa-mir-412
(42 sentences)

Stem-loop
   ----cug      gg      a    c      u   aa    -    u 
5'        ggguac  ggaugg uggu gaccag ugg  agua auug u
          ||||||  |||||| |||| |||||| |||  |||| ||||  
3'        ccuaug  ccugcc auca cugguc acu  ucau uaau u
   gacgucg      --      g    c      c   --    g    c 
Get sequence
Deep sequencing
576 reads, 0 reads per million, 84 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101065447-101065537 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-412
hsa-mir-323bchr14: 101056219-101056300 [+]
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
hsa-mir-541chr14: 101064495-101064578 [+]
hsa-mir-409chr14: 101065300-101065378 [+]
hsa-mir-412chr14: 101065447-101065537 [+]
hsa-mir-369chr14: 101065598-101065667 [+]
hsa-mir-410chr14: 101065912-101065991 [+]
hsa-mir-656chr14: 101066724-101066801 [+]
Database links

Mature sequence hsa-miR-412-5p

Accession MIMAT0026557
Sequence

19 - 

uggucgaccaguuggaaaguaau

 - 41

Get sequence
Deep sequencing563 reads, 83 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence hsa-miR-412-3p

Accession MIMAT0002170
Sequence

54 - 

acuucaccugguccacuagccgu

 - 76

Get sequence
Deep sequencing11 reads, 7 experiments
Evidence by similarity; MI0001164
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).