Stem-loop sequence hsa-mir-3978

AccessionMI0016996 (change log)
Symbol HGNC:MIR3978
DescriptionHomo sapiens miR-3978 stem-loop
Stem-loop
       u       -    au       ----    agccaaaauuagaagggcc 
5' ucag ggaaagc augc  ccagggu    gugg                   a
   |||| ||||||| ||||  |||||||    ||||                    
3' aguu ucuuuug uacg  gguucca    cacc                   a
       u       c    --       acga    aucacccgguccaucuuaa 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 110082118-110082218 [+]
intergenic
Database links

Mature sequence hsa-miR-3978

Accession MIMAT0019363
Sequence

4 - 

guggaaagcaugcauccagggugu

 - 27

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20876853 "Complete characterization of the microRNAome in a patient with acute myeloid leukemia" Ramsingh G, Koboldt DC, Trissal M, Chiappinelli KB, Wylie T, Koul S, Chang LW, Nagarajan R, Fehniger TA, Goodfellow P, Magrini V, Wilson RK, Ding L, Ley TJ, Mardis ER, Link DC Blood. 116:5316-5326(2010).