Stem-loop sequence hsa-mir-3977

AccessionMI0016995 (change log)
Symbol HGNC:MIR3977
DescriptionHomo sapiens miR-3977 stem-loop
Stem-loop
   -  g    -u  u      uaaccuu        cg 
5'  uu ugcu  ca cguaau       aagugguu  g
    || ||||  || ||||||       ||||||||   
3'  aa acgg  gu guauug       uucacuaa  g
   u  g    uu  -      -uuuaau        au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 82840155-82840224 [+]
sense
OTTHUMT00000369623 ; VCAN-006; intron 1
OTTHUMT00000369646 ; VCAN-011; intron 1
OTTHUMT00000369622 ; VCAN-005; intron 6
OTTHUMT00000369619 ; VCAN-002; intron 7
OTTHUMT00000254092 ; VCAN-001; intron 8
ENST00000513016 ; VCAN-006; intron 1
ENST00000507162 ; VCAN-011; intron 1
ENST00000502527 ; VCAN-005; intron 6
ENST00000512590 ; VCAN-002; intron 7
ENST00000343200 ; VCAN-202; intron 7
ENST00000342785 ; VCAN-201; intron 7
ENST00000265077 ; VCAN-001; intron 8
antisense
OTTHUMT00000369640 ; CTC-348L14.1-002; intron 1
OTTHUMT00000369639 ; CTC-348L14.1-001; intron 1
ENST00000512090 ; VCAN-AS1-002; intron 1
ENST00000513899 ; VCAN-AS1-001; intron 1
Database links

Mature sequence hsa-miR-3977

Accession MIMAT0019362
Sequence

3 - 

gugcuucaucguaauuaaccuua

 - 25

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20876853 "Complete characterization of the microRNAome in a patient with acute myeloid leukemia" Ramsingh G, Koboldt DC, Trissal M, Chiappinelli KB, Wylie T, Koul S, Chang LW, Nagarajan R, Fehniger TA, Goodfellow P, Magrini V, Wilson RK, Ding L, Ley TJ, Mardis ER, Link DC Blood. 116:5316-5326(2010).