Stem-loop sequence hsa-mir-3975

AccessionMI0016993 (change log)
Symbol HGNC:MIR3975
DescriptionHomo sapiens miR-3975 stem-loop
Stem-loop
        -    g    -   -   --     aaaag  u 
5' caugu aggu agug auu gcu  auuuc     ac a
   ||||| |||| |||| ||| |||  |||||     || g
3' guaca uuca ucac uaa cgg  uaaag     ug a
        c    -    g   u   ag     ---ga  g 
Get sequence
Deep sequencing
5 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 35591737-35591806 [+]
intergenic
Database links

Mature sequence hsa-miR-3975

Accession MIMAT0019360
Sequence

46 - 

ugaggcuaaugcacuacuucac

 - 67

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20876853 "Complete characterization of the microRNAome in a patient with acute myeloid leukemia" Ramsingh G, Koboldt DC, Trissal M, Chiappinelli KB, Wylie T, Koul S, Chang LW, Nagarajan R, Fehniger TA, Goodfellow P, Magrini V, Wilson RK, Ding L, Ley TJ, Mardis ER, Link DC Blood. 116:5316-5326(2010).