Stem-loop sequence hsa-mir-3974

AccessionMI0016992 (change log)
Symbol HGNC:MIR3974
DescriptionHomo sapiens miR-3974 stem-loop
Stem-loop
   ----guu     -----a      cau   aa      ugcacc    u   aa 
5'        caggg      aaaggu   ugu  gguuaa      caua uuu  u
          |||||      ||||||   |||  ||||||      |||| |||   
3'        guccc      uuuccg   aca  ucaguu      guau aaa  a
   caaaacc     caugcc      ---   --      uaaaca    c   cu 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 17673299-17673394 [+]
antisense
OTTHUMT00000401154 ; RP11-871F6.3-001; intron 7
ENST00000540399 ; RP11-871F6.3-001; intron 7
Database links

Mature sequence hsa-miR-3974

Accession MIMAT0019359
Sequence

10 - 

aaaggucauuguaagguuaaugc

 - 32

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20876853 "Complete characterization of the microRNAome in a patient with acute myeloid leukemia" Ramsingh G, Koboldt DC, Trissal M, Chiappinelli KB, Wylie T, Koul S, Chang LW, Nagarajan R, Fehniger TA, Goodfellow P, Magrini V, Wilson RK, Ding L, Ley TJ, Mardis ER, Link DC Blood. 116:5316-5326(2010).