Stem-loop sequence hsa-mir-3973

AccessionMI0016991 (change log)
Symbol HGNC:MIR3973
DescriptionHomo sapiens miR-3973 stem-loop
Stem-loop
     cc   g   cucu       gc     -a      agga        -  c     
5' gc  agg uag    cuguauu  uuguu  cauuuu    uugcuugc cc uugc 
   ||  ||| |||    |||||||  |||||  ||||||    |||||||| || ||| u
3' cg  ucc auu    gacauga  aacaa  guaaag    gacggacg gg aacc 
     au   g   --ac       --     ac      --aa        u  u     
Get sequence
Deep sequencing
23 reads, 200 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 36010098-36010204 [+]
sense
OTTHUMT00000389083 ; LDLRAD3-002; intron 1
OTTHUMT00000389084 ; LDLRAD3-003; intron 1
OTTHUMT00000389085 ; LDLRAD3-001; intron 1
OTTHUMT00000389086 ; LDLRAD3-004; intron 1
OTTHUMT00000389089 ; RP5-916O11.2-001; intron 1
ENST00000528989 ; LDLRAD3-002; intron 1
ENST00000524419 ; LDLRAD3-003; intron 1
ENST00000315571 ; LDLRAD3-001; intron 1
ENST00000532490 ; LDLRAD3-004; intron 1
ENST00000534594 ; RP5-916O11.2-001; intron 1
Database links

Mature sequence hsa-miR-3973

Accession MIMAT0019358
Sequence

84 - 

acaaaguacagcauuagccuuag

 - 106

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20876853 "Complete characterization of the microRNAome in a patient with acute myeloid leukemia" Ramsingh G, Koboldt DC, Trissal M, Chiappinelli KB, Wylie T, Koul S, Chang LW, Nagarajan R, Fehniger TA, Goodfellow P, Magrini V, Wilson RK, Ding L, Ley TJ, Mardis ER, Link DC Blood. 116:5316-5326(2010).