Stem-loop sequence hsa-mir-3972

AccessionMI0016990 (change log)
Symbol HGNC:MIR3972
DescriptionHomo sapiens miR-3972 stem-loop
Stem-loop
   --  ccauu        cu     -      -   --ug   g a g 
5'   gc     ugccuugg  ugggg uggcag ucc    ugg a u a
     ||     ||||||||  ||||| |||||| |||    ||| | |  
3'   cg     acgggacc  gcccc accguc agg    acc u g g
   ua  ---ac        uu     g      c   ucaa   g a a 
Get sequence
Deep sequencing
13 reads, 122 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 17277889-17277975 [+]
sense
OTTHUMT00000006587 ; CROCC-012; intron 3
OTTHUMT00000006586 ; CROCC-011; intron 4
OTTHUMT00000006581 ; CROCC-006; intron 5
OTTHUMT00000006579 ; CROCC-004; intron 15
OTTHUMT00000006250 ; CROCC-002; intron 17
OTTHUMT00000006249 ; CROCC-001; intron 20
ENST00000498688 ; CROCC-012; intron 3
ENST00000486318 ; CROCC-011; intron 4
ENST00000494191 ; CROCC-006; intron 5
ENST00000467938 ; CROCC-004; intron 15
ENST00000445545 ; CROCC-002; intron 17
ENST00000375541 ; CROCC-001; intron 20
Database links

Mature sequence hsa-miR-3972

Accession MIMAT0019357
Sequence

60 - 

cugccagccccguuccagggca

 - 81

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20876853 "Complete characterization of the microRNAome in a patient with acute myeloid leukemia" Ramsingh G, Koboldt DC, Trissal M, Chiappinelli KB, Wylie T, Koul S, Chang LW, Nagarajan R, Fehniger TA, Goodfellow P, Magrini V, Wilson RK, Ding L, Ley TJ, Mardis ER, Link DC Blood. 116:5316-5326(2010).