Stem-loop sequence hsa-mir-3945

AccessionMI0016602 (change log)
Symbol HGNC:MIR3945
DescriptionHomo sapiens miR-3945 stem-loop
Literature search

2 open access papers mention hsa-mir-3945
(3 sentences)

Stem-loop
   gau     --ugca g g  -gg             gag     a  uaaa 
5'    guuga      c u ac   ggagggcauagga   gguug ua    a
      |||||      | | ||   |||||||||||||   ||||| ||    u
3'    uaacu      g g ug   ccuuucguauucu   ccgac au    g
   uag     uaguag g g  aaa             ---     -  uaac 
Get sequence
Deep sequencing
45 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 184851013-184851110 [-]
antisense
OTTHUMT00000361439 ; STOX2-005; intron 1
OTTHUMT00000361433 ; STOX2-001; intron 1
ENST00000511250 ; STOX2-005; intron 1
ENST00000308497 ; STOX2-001; intron 1
ENST00000438269 ; STOX2-201; intron 1
Database links

Mature sequence hsa-miR-3945

Accession MIMAT0018361
Sequence

23 - 

agggcauaggagaggguugauau

 - 45

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1