Stem-loop sequence hsa-mir-3944

AccessionMI0016601 (change log)
Symbol HGNC:MIR3944
DescriptionHomo sapiens miR-3944 stem-loop
Stem-loop
   ---uccacccag             u u           -a       ------   c 
5'             caggcgcaggucc g gcagcaggcca  ccgagaa      gcg c
               ||||||||||||| | |||||||||||  |||||||      |||  
3'             guccguguccagg c cgucguccggu  ggcuuuu      ugc u
   gucguaauucua             c u           cg       acccuc   g 
Get sequence
Deep sequencing
305 reads, 10.6 reads per million, 66 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 133371556-133371663 [-]
intergenic
Database links

Mature sequence hsa-miR-3944-5p

Accession MIMAT0019231
Sequence

23 - 

ugugcagcaggccaaccgaga

 - 43

Get sequence
Deep sequencing149 reads, 42 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3944-3p

Accession MIMAT0018360
Previous IDshsa-miR-3944
Sequence

63 - 

uucgggcuggccugcugcuccgg

 - 85

Get sequence
Deep sequencing149 reads, 37 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).