Stem-loop sequence hsa-mir-3943

AccessionMI0016600 (change log)
Symbol HGNC:MIR3943
DescriptionHomo sapiens miR-3943 stem-loop
Gene family MIPF0001400; mir-3943
Literature search

1 open access papers mention hsa-mir-3943
(1 sentences)

Stem-loop
   ---cacacagac g      c      g     ag    c        u g 
5'             g cagcug ggccua ccccc  gcuu acuuggcg g a
               | |||||| |||||| |||||  |||| |||||||| | c
3'             c gucggc ccgggu ggggg  ugaa ugaaucgu c a
   cagguccauccu g      a      g     --    a        u a 
Get sequence
Deep sequencing
1285 reads, 0 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 43150895-43150994 [+]
intergenic
Database links

Mature sequence hsa-miR-3943

Accession MIMAT0018359
Sequence

23 - 

uagcccccaggcuucacuuggcg

 - 45

Get sequence
Deep sequencing1264 reads, 67 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1