Stem-loop sequence hsa-mir-3942

AccessionMI0016599 (change log)
Symbol HGNC:MIR3942
DescriptionHomo sapiens miR-3942 stem-loop
Literature search

2 open access papers mention hsa-mir-3942
(6 sentences)

Stem-loop
   ucu     ----       c       a c          c       ag    cga 
5'    ucagu    augacac ucaaaga g aauacuguua cugaaau  gcug   a
      |||||    ||||||| ||||||| | |||||||||| |||||||  ||||   g
3'    aguca    uacugug aguuucu c uuaugacaau gacuuua  ugac   a
   --c     cuua       a       a a          a       --    aau 
Get sequence
Deep sequencing
293 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 35372256-35372364 [-]
intergenic
Database links

Mature sequence hsa-miR-3942-5p

Accession MIMAT0018358
Previous IDshsa-miR-3942
Sequence

23 - 

aagcaauacuguuaccugaaau

 - 44

Get sequence
Deep sequencing165 reads, 46 experiments
Evidence experimental; Illumina [1-3]
Predicted targets

Mature sequence hsa-miR-3942-3p

Accession MIMAT0019230
Sequence

65 - 

uuucagauaacaguauuacau

 - 85

Get sequence
Deep sequencing127 reads, 34 experiments
Evidence experimental; Illumina [2-3]
Predicted targets

References

1
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).