Stem-loop sequence hsa-mir-3941

AccessionMI0016598 (change log)
Symbol HGNC:MIR3941
DescriptionHomo sapiens miR-3941 stem-loop
Literature search

1 open access papers mention hsa-mir-3941
(2 sentences)

Stem-loop
   gagu     --uuc               g                uugaaa 
5'     cagaa     ucaucaggcugugau cucaguuguguguaga      g
       |||||     ||||||||||||||| ||||||||||||||||       
3'     guuuu     gguaguccgauacua gagucaacacacauuu      c
   -uuu     uccuu               g                uaaucc 
Get sequence
Deep sequencing
96 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 122416965-122417067 [+]
intergenic
Database links

Mature sequence hsa-miR-3941

Accession MIMAT0018357
Sequence

60 - 

uuacacacaacugaggaucaua

 - 81

Get sequence
Deep sequencing38 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1