Stem-loop sequence hsa-mir-3940

AccessionMI0016597 (change log)
Symbol HGNC:MIR3940
DescriptionHomo sapiens miR-3940 stem-loop
Gene family MIPF0001599; mir-3940
Literature search

13 open access papers mention hsa-mir-3940
(22 sentences)

Stem-loop
   gcuuauc     -aaa         ----         --      c     au 
5'        gagga    gaucgaggu    ggguugggg  cgggcu ugggg  u
          |||||    |||||||||    |||||||||  |||||| |||||   
3'        uuccu    uugguucca    cccgacccu  gcccga acucu  u
   -ucuucc     cuca         uuca         ag      c     gg 
Get sequence
Deep sequencing
518 reads, 0.952 reads per million, 105 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 6416410-6416511 [-]
sense
OTTHUMT00000453308 ; KHSRP-005; exon 3
OTTHUMT00000453305 ; KHSRP-001; exon 15
ENST00000579148 ; MIR3940-201; exon 1
ENST00000595223 ; KHSRP-005; exon 3
ENST00000398148 ; KHSRP-001; exon 15
Database links

Mature sequence hsa-miR-3940-5p

Accession MIMAT0019229
Sequence

23 - 

guggguuggggcgggcucug

 - 42

Get sequence
Deep sequencing49 reads, 26 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3940-3p

Accession MIMAT0018356
Previous IDshsa-miR-3940
Sequence

57 - 

cagcccggaucccagcccacuu

 - 78

Get sequence
Deep sequencing450 reads, 97 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).