Stem-loop sequence hsa-mir-3938

AccessionMI0016594 (change log)
Symbol HGNC:MIR3938
DescriptionHomo sapiens miR-3938 stem-loop
Gene family MIPF0001520; mir-3938
Stem-loop
   --a   -auu       c      ua a                     uuu 
5'    gga    uuuaacc gaucac  g uuaucuacaagggaauuuuuu   a
      |||    ||||||| ||||||  | |||||||||||||||||||||    
3'    ccu    agguugg cuggug  c aauagauguucccuuaaaaaa   a
   gua   cggu       a      gc c                     uuu 
Get sequence
Deep sequencing
309 reads, 0 reads per million, 58 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 55852492-55852594 [-]
sense
OTTHUMT00000350954 ; ERC2-006; intron 11
OTTHUMT00000350884 ; ERC2-001; intron 14
OTTHUMT00000350953 ; ERC2-005; intron 14
ENST00000492584 ; ERC2-006; intron 11
ENST00000288221 ; ERC2-001; intron 14
ENST00000460849 ; ERC2-005; intron 14
Database links

Mature sequence hsa-miR-3938

Accession MIMAT0018353
Sequence

59 - 

aauucccuuguagauaacccgg

 - 80

Get sequence
Deep sequencing272 reads, 48 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1