Stem-loop sequence hsa-mir-3937

AccessionMI0016593 (change log)
Symbol HGNC:MIR3937
DescriptionHomo sapiens miR-3937 stem-loop
Gene family MIPF0001500; mir-3937
Stem-loop
   ---agaa  -       a         a           uc         -  a 
5'        ga augccca ccagcccuc guugcuacagu  ccuguuguu uc g
          || ||||||| ||||||||| |||||||||||  ||||||||| || c
3'        cu uacgggu ggucggggg uaacgaugucg  ggacaacaa ag u
   cguguaa  c       a         g           gc         c  c 
Get sequence
Deep sequencing
73 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 39661216-39661321 [+]
intergenic
Database links

Mature sequence hsa-miR-3937

Accession MIMAT0018352
Sequence

61 - 

acaggcggcuguagcaauggggg

 - 83

Get sequence
Deep sequencing53 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1