Stem-loop sequence hsa-mir-3936

AccessionMI0016592 (change log)
Symbol HGNC:MIR3936
DescriptionHomo sapiens miR-3936 stem-loop
Stem-loop
   --a  a uc  a         --ca            g      caaau  ----    u 
5'    ug u  ag gcaucuguc    gugucugcugua aucccu     cc    gugu u
      || |  || |||||||||    |||||||||||| ||||||     ||    ||||  
3'    ac g  uc cguagacag    cguagacgguau ugggga     gg    cgca g
   acg  - gu  a         ccca            g      ---au  ucuu    g 
Get sequence
Deep sequencing
217 reads, 0 reads per million, 58 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 132365490-132365599 [-]
intergenic
Database links

Mature sequence hsa-miR-3936

Accession MIMAT0018351
Sequence

66 - 

uaagggguguauggcagaugca

 - 87

Get sequence
Deep sequencing196 reads, 48 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

References

1
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).