Stem-loop sequence hsa-mir-3934

AccessionMI0016590 (change log)
Symbol HGNC:MIR3934
DescriptionHomo sapiens miR-3934 stem-loop
Gene family MIPF0001584; mir-3934
Literature search

3 open access papers mention hsa-mir-3934
(7 sentences)

Stem-loop
   -cacagccc       cc   g  uu   g    g  a     g    ag  ag 
5'          uuccugu  cca uu  cag ugug aa cugag cagg  gc  u
            |||||||  ||| ||  ||| |||| || ||||| ||||  ||   
3'          agggacg  ggu aa  guc acac uu gacuc guuc  ug  g
   ccuaaguuu       -a   g  gg   g    g  g     -    aa  aa 
Get sequence
Deep sequencing
2249 reads, 1.16 reads per million, 86 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 33698128-33698234 [+]
antisense
OTTHUMT00000040203 ; IP6K3-002; intron 2
ENST00000293756 ; IP6K3-002; intron 2
ENST00000451316 ; IP6K3-201; intron 3
Database links

Mature sequence hsa-miR-3934-5p

Accession MIMAT0018349
Previous IDshsa-miR-3934
Sequence

25 - 

ucagguguggaaacugaggcag

 - 46

Get sequence
Deep sequencing2188 reads, 81 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-3934-3p

Accession MIMAT0022975
Sequence

64 - 

ugcucagguugcacagcuggga

 - 85

Get sequence
Deep sequencing23 reads, 14 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).