Stem-loop sequence hsa-mir-3929

AccessionMI0016439 (change log)
Symbol HGNC:MIR3929
DescriptionHomo sapiens miR-3929 stem-loop
Literature search

2 open access papers mention hsa-mir-3929
(2 sentences)

Stem-loop
        ----      c    aa      c 
5' agugg    cucaca cagu  ucccag a
   |||||    |||||| ||||  ||||||  
3' ucacc    gagugu gucg  aggguu c
        agau      a    -g      u 
Get sequence
Deep sequencing
11224 reads, 238 reads per million, 155 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 35934088-35934142 [-]
intergenic
Database links

Mature sequence hsa-miR-3929

Accession MIMAT0018206
Sequence

33 - 

gaggcugaugugaguagaccacu

 - 55

Get sequence
Deep sequencing2212 reads, 102 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).