Stem-loop sequence hsa-mir-3928

AccessionMI0016438 (change log)
Symbol HGNC:MIR3928
DescriptionHomo sapiens miR-3928 stem-loop
Literature search

2 open access papers mention hsa-mir-3928
(3 sentences)

Stem-loop
                      gc    ggg 
5' gcugaagcucuaagguucc  cugc   c
   |||||||||||||||||||  ||||   a
3' cggcuucgagguuccaagg  ggcg   g
                      -a    aag 
Get sequence
Deep sequencing
5054 reads, 1.12 reads per million, 89 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 31160062-31160119 [-]
antisense
OTTHUMT00000321548 ; OSBP2-002; intron 2
OTTHUMT00000321547 ; OSBP2-001; intron 2
OTTHUMT00000321551 ; OSBP2-005; intron 2
ENST00000407373 ; OSBP2-002; intron 2
ENST00000332585 ; OSBP2-001; intron 2
ENST00000446658 ; OSBP2-005; intron 2
ENST00000382310 ; OSBP2-201; intron 2
ENST00000403222 ; OSBP2-202; intron 3
Database links

Mature sequence hsa-miR-3928-5p

Accession MIMAT0027037
Sequence

3 - 

ugaagcucuaagguuccgccugc

 - 25

Get sequence
Deep sequencing28 reads, 19 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3928-3p

Accession MIMAT0018205
Sequence

37 - 

ggaggaaccuuggagcuucggc

 - 58

Get sequence
Deep sequencing5007 reads, 82 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).