Stem-loop sequence hsa-mir-3927

AccessionMI0016435 (change log)
Symbol HGNC:MIR3927
DescriptionHomo sapiens miR-3927 stem-loop
Gene family MIPF0001462; mir-3927
Literature search

1 open access papers mention hsa-mir-3927
(2 sentences)

Stem-loop
   u              c           u  u   a 
5'  gccaaugccuauca auaucugccug cc aug c
    |||||||||||||| ||||||||||| || ||| a
3'  cgguuacggauagu uauagauggac gg uac a
   a              u           -  -   a 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 109511475-109511545 [-]
intergenic
Database links

Mature sequence hsa-miR-3927-5p

Accession MIMAT0022970
Sequence

8 - 

gccuaucacauaucugccugu

 - 28

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3927-3p

Accession MIMAT0018202
Previous IDshsa-miR-3927
Sequence

45 - 

cagguagauauuugauaggcau

 - 66

Get sequence
Deep sequencing26 reads, 14 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).