Stem-loop sequence hsa-mir-3926-1

AccessionMI0016434 (change log)
Symbol HGNC:MIR3926-1
DescriptionHomo sapiens miR-3926-1 stem-loop
Gene family MIPF0001118; mir-3926
Stem-loop
                                   uuu 
5' aaaauggagcuggccaaaaagcaggcagagac   a
   ||||||||||||||||||||||||||||||||   a
3' uuuugccucgaccgguuuuucguccgucucug   a
                                   cga 
Get sequence
Deep sequencing
184 reads, 5.88 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 12727232-12727304 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-3926-1
hsa-mir-3926-2chr8: 12727237-12727299 [+]
hsa-mir-3926-1chr8: 12727232-12727304 [-]
hsa-mir-5692a-2chr8: 12719132-12719190 [+]
Database links

Mature sequence hsa-miR-3926

Accession MIMAT0018201
Sequence

11 - 

uggccaaaaagcaggcagaga

 - 31

Get sequence
Deep sequencing217 reads, 48 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).