Stem-loop sequence hsa-mir-3925

AccessionMI0016433 (change log)
Symbol HGNC:MIR3925
DescriptionHomo sapiens miR-3925 stem-loop
Stem-loop
                           g     c   uca 
5' gugggaauagcaagagaacugaaa uggag cug   c
   |||||||||||||||||||||||| ||||| |||   a
3' caccuuuaucguucucuugauuuu accuc gac   u
                           g     a   cuc 
Get sequence
Deep sequencing
31 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 36622436-36622512 [-]
intergenic
Database links

Mature sequence hsa-miR-3925-5p

Accession MIMAT0018200
Previous IDshsa-miR-3925
Sequence

12 - 

aagagaacugaaaguggagccu

 - 33

Get sequence
Deep sequencing20 reads, 13 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence hsa-miR-3925-3p

Accession MIMAT0019228
Sequence

47 - 

acuccaguuuuaguucucuug

 - 67

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).