Stem-loop sequence hsa-mir-3924

AccessionMI0016432 (change log)
Symbol HGNC:MIR3924
DescriptionHomo sapiens miR-3924 stem-loop
Stem-loop
       ug               a       g    a   c 
5' uaaa  aaaaaguaguaguca auaugca aucu ugu a
   ||||  ||||||||||||||| ||||||| |||| ||| u
3' auuu  uuuuucaucgucagu uauaugu uaga aua a
       gu               g       a    c   u 
Get sequence
Deep sequencing
10 reads, 100 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 57304479-57304559 [-]
sense
OTTHUMT00000291346 ; PCDH15-019; intron 2
OTTHUMT00000291347 ; RP11-168O22.1-001; intron 2
ENST00000373957 ; PCDH15-019; intron 2
ENST00000457975 ; RP11-168O22.1-001; intron 2
Database links

Mature sequence hsa-miR-3924

Accession MIMAT0018199
Sequence

50 - 

auauguauaugugacugcuacu

 - 71

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).