Stem-loop sequence hsa-mir-3923

AccessionMI0016430 (change log)
Symbol HGNC:MIR3923
DescriptionHomo sapiens miR-3923 stem-loop
Gene family MIPF0001527; mir-3923
Literature search

2 open access papers mention hsa-mir-3923
(2 sentences)

Stem-loop
                                  ---       a 
5' gguagagugagcucuaauccaauauuacuag   cuucuuu u
   |||||||||||||||||||||||||||||||   |||||||  
3' ucaucucacucgggauuagguuguaaugauc   ggagaag a
                                  aaa       a 
Get sequence
Deep sequencing
71 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 79507887-79507969 [+]
antisense
OTTHUMT00000352610 ; ROBO1-001; intron 2
ENST00000464233 ; ROBO1-001; intron 2
Database links

Mature sequence hsa-miR-3923

Accession MIMAT0018198
Sequence

51 - 

aacuaguaauguuggauuaggg

 - 72

Get sequence
Deep sequencing52 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).